View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_high_10 (Length: 366)
Name: NF12947_high_10
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 356
Target Start/End: Original strand, 52273980 - 52274320
Alignment:
| Q |
18 |
aatcttcgtcgctatccatgtttgattctgagatctgaacgacactttttggttttggaaacaaaggctttaaccttgtcgaattaaaacggatcgtgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52273980 |
aatcttcgtcgctatccatgtttgattctgagatctgaacgacactttttggttttggaaacaaaggctttaaccttatcgaattaaaacggatcgtgaa |
52274079 |
T |
|
| Q |
118 |
atggttctagtccaaacctaacctaaataaatggcggtaaatttgtttgaaaattctat--aaacgcgccatacnnnnnnnnnnnnnngaaattgctttt |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
52274080 |
atggttctagtctaaacctaacctaaataaatggcggtaaatttgtttgaaaattctataaaaacgcgccatac------aaaaaaaagaaattgctttt |
52274173 |
T |
|
| Q |
216 |
attttaacgcca------nnnnnnnnnncaatttaatttaattttgcacatgttaatttagctaggtatacgggtctctgtttacacttttttgggtcag |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52274174 |
attttaacgccatttttttttttcaatttaatttaatttaattttgcacatgttaatttagctaggtatacgggtctctgtttacacttttttgggtcag |
52274273 |
T |
|
| Q |
310 |
actgcaatgacctacaaacttaataaaatcgattgttccaccctttg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52274274 |
actgcaatgacctacaaacttaataaaattgattgttccaccctttg |
52274320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University