View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_high_11 (Length: 345)
Name: NF12947_high_11
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 3e-42; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 111 - 202
Target Start/End: Original strand, 44043632 - 44043723
Alignment:
| Q |
111 |
tcaattttgggattaatcaaaatagctagaacgcccctgaattttataatattcaatcaatttagtctatccgtcaagtctcgcgcgttgac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44043632 |
tcaattttgggattaatcaaaatagctagaacgcccctggattttataatattcaatcaatttagtctatccgtcaagtctcgcgcgttgac |
44043723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 44043599 - 44043638
Alignment:
| Q |
1 |
ttgtttgatttgatttatctatccggttcttgttcaattt |
40 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44043599 |
ttgtttgatttgatttatctattcggttcttgttcaattt |
44043638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 145 - 194
Target Start/End: Original strand, 26778590 - 26778639
Alignment:
| Q |
145 |
ccctgaattttataatattcaatcaatttagtctatccgtcaagtctcgc |
194 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
26778590 |
ccctgaattttataaacgtcaatcaatttagtctctccgtcaagtctcgc |
26778639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 130 - 174
Target Start/End: Original strand, 5904535 - 5904579
Alignment:
| Q |
130 |
aaatagctagaacgcccctgaattttataatattcaatcaattta |
174 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||| ||||||||| |
|
|
| T |
5904535 |
aaatagctagaatgtctctgaattttataatattctatcaattta |
5904579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University