View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_high_18 (Length: 247)
Name: NF12947_high_18
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 98 - 232
Target Start/End: Original strand, 404085 - 404219
Alignment:
| Q |
98 |
tctctccaagagatggaacattcgtcctctatggcctttcgttcccgttatagacttcagcttttcaaccatattttttcctccatgtttcttgagcgag |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
404085 |
tctctccaagagatggaacattcgtcccctatggcctttcgttcccgttatagacttcagcgtttcaaccatattttttcctccatttttcttgagcgag |
404184 |
T |
 |
| Q |
198 |
aactcgttggttttcattccatcaacagtttcttc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
404185 |
aactcgttggttttcattccatcaacagtttcttc |
404219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 61
Target Start/End: Original strand, 404043 - 404090
Alignment:
| Q |
14 |
agacaggttgagcagtttaccagatgagatcatttgccacattctctc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
404043 |
agacaggttgagcagtttaccagatgagatcatttgccacattctctc |
404090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University