View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_high_19 (Length: 245)
Name: NF12947_high_19
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_high_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 7815528 - 7815300
Alignment:
| Q |
17 |
atgtgtccctcaacatttattaattggtcacttctcaacagtacatggaacacaggagcatgttcaatcggtagtttaagaatcgaggaattctctgttt |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815528 |
atgtgtccctcaaaatttattaattggtcacttctcaacagtacatggaacacaggagcatgttcaatcggtagtttaagaatcgaggaattctctgttt |
7815429 |
T |
|
| Q |
117 |
taggaaggtgtcttaactccctatatcgacaaatatccttactaatgtagagcacatcaccactagaatgcttgatagcgttaaaggactagtgcgactc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815428 |
taggaaggtgtcttaactccctatatcgacaaatatccttactaatgtagagcacatcaccactagaatgcttgatagcgttaaaggactagtgcgactc |
7815329 |
T |
|
| Q |
217 |
cgattttaagattctacctcgtcatcatt |
245 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
7815328 |
agattttaagattctacctcgtgatcatt |
7815300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University