View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_high_21 (Length: 235)
Name: NF12947_high_21
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 47925626 - 47925410
Alignment:
| Q |
1 |
aaagaaccataagactattaatacttttgagtgaaattcaacagagaatttaaagaggtcaaagatattcagtctaattttaaaactaaataccattggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47925626 |
aaagaaccataagactattaatactttt-agtgaaattcaacagagaatttaaagaggtcaaagatattcagtctaattttaaaactaaataccattggc |
47925528 |
T |
 |
| Q |
101 |
attttaaatcaatttgcgtgtttgtcttagcaattccaatgcattttgtgattttatactacagtattaaacaagaatctgaaaatacgttagttgcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47925527 |
attttaaatcaatttgcgtgtttgtcttggcaattccaatgcattttgtgattttatactacagtattaaacaagaatctgaaaatacgttaattgcatt |
47925428 |
T |
 |
| Q |
201 |
acaattacggttaacaag |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47925427 |
acaattacggttaacaag |
47925410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University