View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_low_12 (Length: 311)
Name: NF12947_low_12
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 38927643 - 38927944
Alignment:
| Q |
1 |
tagttcaacttgtttattttcttcctccgacaacaagcttccaagaacagttccataaggaatgtaaagattattatcatgccactgtgatgagttttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38927643 |
tagttcaacttgtttattttcttcctccgacaacaagcttccaagaacagttccataaggaatgtaaagattattatcatgccactgtgatgagttctgg |
38927742 |
T |
 |
| Q |
101 |
atatacttcgttcctgcaagtgttattatatcttctgttgacaacttttgcggacttgcacaagtttcaacattgcttttgnnnnnnngcttattgaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38927743 |
atatacttcgttcctgcaagtgttattatatcttctgttgacaacttttgaggacttgcacaagtttcaacattgcttttgtttttttgcttattgaact |
38927842 |
T |
 |
| Q |
201 |
tgcttccataatttttcaatagctcaagtgatgctaatgaagatggtggtggcttttgcacctgcttaagagttggaattgatattatagcttgatattc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38927843 |
tgcttccataatttttcaatagctcaagtgatgctaatgaagatggtggtggcttttgcacctgcttaagagttggaattgatattatagcttgattttc |
38927942 |
T |
 |
| Q |
301 |
tt |
302 |
Q |
| |
|
|| |
|
|
| T |
38927943 |
tt |
38927944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University