View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12947_low_20 (Length: 247)
Name: NF12947_low_20
Description: NF12947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12947_low_20 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 45729121 - 45729357
Alignment:
| Q |
11 |
gagatgaacacacacatggaagatggtaaaaaacaagttgcagagnnnnnnntgaagagattccttctcgtagtaaattgtctcatattatccctaggta |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729121 |
gagaagaacacacacatggaagatggtaaaaaacaagttgcagagaaaaaaatgaagagattccttctcgtagtaaattgtctcatattatccctaggta |
45729220 |
T |
|
| Q |
111 |
cctgcagtgctcccctcataatgcgtctctatttcatccacggcggccaacgtgtctggctctccgccttcctccaaaccgccggtttccccttgatgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729221 |
cctgcagtgctcccctcataatgcgtctctatttcatccacggcggccaacgtgtctggctctccgccttcctccaaaccgccggtttccccttgatgct |
45729320 |
T |
|
| Q |
211 |
cattcccctcgcaatctcatacatcaaacgccaccgt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729321 |
cattcccctcgcaatctcatacatcaaacgccaccgt |
45729357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 70 - 240
Target Start/End: Original strand, 45724991 - 45725161
Alignment:
| Q |
70 |
attccttctcgtagtaaattgtctcatattatccctaggtacctgcagtgctcccctcataatgcgtctctatttcatccacggcggccaacgtgtctgg |
169 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||| || | ||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45724991 |
attccttctgatagtaaattgtctgatattagccctaggtaactccggtggtcccctaataatgcgtctctatttcatccacggcggccaacgtgtctgg |
45725090 |
T |
|
| Q |
170 |
ctctccgccttcctccaaaccgccggtttccccttgatgctcattcccctcgcaatctcatacatcaaacg |
240 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
45725091 |
ctctccgcctgcctggaaactgccggtttccccttgatgctcattcccctcacaatctcatacatccaacg |
45725161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University