View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12948_low_9 (Length: 222)
Name: NF12948_low_9
Description: NF12948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12948_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 12 - 119
Target Start/End: Complemental strand, 45122273 - 45122166
Alignment:
| Q |
12 |
agtgagatgaacttagtattgatttataatatcaacactcgggcacttgaatattgctcaaaaagaatgttagtgtagagattttattaccgagtaaaaa |
111 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45122273 |
agtgagaagaacttagcattgatttataatatcaacactcggccacttgaatattgctcaaaaagaatgttagtgtagagattttattactgagtaaaaa |
45122174 |
T |
 |
| Q |
112 |
atatgtat |
119 |
Q |
| |
|
|||||||| |
|
|
| T |
45122173 |
atatgtat |
45122166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 45122085 - 45122028
Alignment:
| Q |
105 |
gtaaaaaatatgtattcagtgtctgatgcaaaaactatttatactatattttttataa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122085 |
gtaaaaaatatgtattcagtgtctgatgcaaaaactatttatactatattttttataa |
45122028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 45121999 - 45121953
Alignment:
| Q |
157 |
ttataagcccaacattttttacccttgatcattcttatatacattgc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45121999 |
ttataagcccaacattttttacccttgatcattcttatatacattgc |
45121953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University