View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12949_high_3 (Length: 339)
Name: NF12949_high_3
Description: NF12949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12949_high_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 121 - 339
Target Start/End: Complemental strand, 16645781 - 16645563
Alignment:
| Q |
121 |
aaatgtccaacttgttatgatcaattaagtattttctagttttggaagatattgtcacatagacatattaagaccctcaagaatcagtatgagtcactct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645781 |
aaatgtccaacttgttatgatcaattaagtattttctagttttggaagatattgtcacatagacatattaagaccctcaagaatcagtatgagtcactct |
16645682 |
T |
 |
| Q |
221 |
cttatccactttttgatatcaattggttgcttgcatgaaagatttttcacctccgacaagaaatacaggaagagacacgtagtgcttatagtattcaagg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645681 |
cttatccactttttgatatcaattggttgcttgcatgaatgatttttcacctccgacaagaaatacaggaagagacacgtagtgcttatagtattcaagg |
16645582 |
T |
 |
| Q |
321 |
acttgacatgtgtagccat |
339 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16645581 |
acttgacatgtgtagccat |
16645563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University