View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12949_high_5 (Length: 299)
Name: NF12949_high_5
Description: NF12949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12949_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 3083291 - 3083007
Alignment:
| Q |
1 |
ttcttatttgatgctaatggaaatcccattcttcatctccgtagatcggttcgttcgtcaactatagaaataacttattatataagagaggaaatattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3083291 |
ttcttatttgatgctaatggaaatcccattcttcatctccgtagatcggttcgttcatcaactatagaaataacttattatataagagatgaaatattaa |
3083192 |
T |
 |
| Q |
101 |
ttaagttgcagcatctaaatgatagttactactttgtttttgcagcttctagcagcagatgattgttggaaagcatatagaggtgaaagcactgagccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3083191 |
ttaagttgcagcatctaaatgatagttactactttgtttttgcagcttctagcagcagatgattgttggaaagcatatagaggtgaaagtactgagccta |
3083092 |
T |
 |
| Q |
201 |
aggatcttatctttactaggaaacgttcatcattgatgcaactaaggaccaaattaaatgtgtttttggcaaataacaacacagg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3083091 |
aggatcttatctttactaggaaacgttcatcattgatgcaactaaggaccaaattaaatgtgtttttggcaaataacaacacagg |
3083007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 3099230 - 3099165
Alignment:
| Q |
1 |
ttcttatttgatgctaatggaaatcccattcttcatctccgtagatcggttcgttcgtcaactata |
66 |
Q |
| |
|
|||||||||||||| |||||||| | |||||| ||||| || | ||||||| |||| ||||||||| |
|
|
| T |
3099230 |
ttcttatttgatgccaatggaaaccgcattctccatcttcgaaaatcggtttgttcatcaactata |
3099165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University