View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12949_low_3 (Length: 362)
Name: NF12949_low_3
Description: NF12949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12949_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 185 - 338
Target Start/End: Complemental strand, 39917737 - 39917584
Alignment:
| Q |
185 |
gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacaacaacgttaacaactcagctatgctgtgatt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917737 |
gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacaacaacgttaacaactcagctatgctgtgatt |
39917638 |
T |
 |
| Q |
285 |
ctaataattaataattaaccccaaaagataagattaagcctaaattacttctac |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917637 |
ctaataattaataattaaccccaaaagataagattaagcctaaattacttctac |
39917584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 12 - 130
Target Start/End: Complemental strand, 39917908 - 39917790
Alignment:
| Q |
12 |
atgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccaaatttatagcccaaaatattgggtaagacctctattcaacagtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917908 |
atgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccagatttatagcccaaaatattgggtaagacctctattcaacagtc |
39917809 |
T |
 |
| Q |
112 |
aaccaccatagcaattagc |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39917808 |
aaccaccatagcaattagc |
39917790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University