View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12949_low_5 (Length: 299)
Name: NF12949_low_5
Description: NF12949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12949_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 11 - 283
Target Start/End: Original strand, 4928435 - 4928705
Alignment:
| Q |
11 |
cagagacaataacttcttgatcttactttggaggtggaattacaaagctaatagtaaaatttgaattttggaaaatgaaaagaacgaggtatgaaaatga |
110 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4928435 |
cagaaacaataacttgttgatcttactttggaggtggaattacaaagctaatagtaaaatttgaattttggaaaatgaaaagaacgaggtatgaaaatga |
4928534 |
T |
 |
| Q |
111 |
tgggaaaggtcggtcactgcaaatgtatcaaggtccttcgtacagggccctccaacttagaggggttagcaaaatatacnnnnnnnnnnnnnnnnnnnnt |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4928535 |
tgggaaaggtcggtcactgcaaatgcatcaaggtccttcgtacagggccctccaacttagaggggttagcaaaatatac--aaaaaaaaaaaaaaaaaat |
4928632 |
T |
 |
| Q |
211 |
tgtttacttacgggcaaaatctgtcactgaatgtcatttttcataagtaaaaatttgagcgacgacaattttg |
283 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
4928633 |
catttacttacgggcaaaatcggtcactgaatgtcatttttcgtaagtaaaaatttgagcaacgacaattttg |
4928705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 11 - 118
Target Start/End: Original strand, 4942766 - 4942873
Alignment:
| Q |
11 |
cagagacaataacttcttgatcttactttggaggtggaattacaaagctaatagtaaaatttgaattttggaaaatgaaaagaacgaggtatgaaaatga |
110 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
4942766 |
cagaaacaataacttattgatcttactttggaggtggaattacaaagctaatagtaaaatttgaattttaaaaaatgaaaagagtgaggtatgtaaatga |
4942865 |
T |
 |
| Q |
111 |
tgggaaag |
118 |
Q |
| |
|
|||||||| |
|
|
| T |
4942866 |
tgggaaag |
4942873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 4937513 - 4937567
Alignment:
| Q |
16 |
acaataacttcttgatcttactttggaggtggaattacaaagctaatagtaaaat |
70 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
4937513 |
acaataacttcttgatcttactatggaggtgggattccaaagctaatagtaaaat |
4937567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University