View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12949_low_7 (Length: 247)
Name: NF12949_low_7
Description: NF12949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12949_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 230
Target Start/End: Complemental strand, 39775977 - 39775762
Alignment:
| Q |
15 |
cataggagaatttgggaaaagtccttgaacccgctaaggattctaactaagcgtgatttatggatcatcgtctgatgcacgaggaggatttgcttgggcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775977 |
cataggagaatttgggaaaagtccttgaacccgctaaggattctaactaagcgtgatttatggatcatcgtctgatgcacgaggaggatttgcttgggcg |
39775878 |
T |
|
| Q |
115 |
cattgatgacgtaatcacttagcatacacatcctttacgtaagaaacaaacaaacatcccttgtctggttacgttgttttatacgatagctttgaattgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775877 |
cattgatgacgtaatcacttagcatacacatcctttacgtaagaaacaaacaaaaatcccttgtctggttacgttgttttatacgatagctttgaattgg |
39775778 |
T |
|
| Q |
215 |
taagtggaaaaaatct |
230 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
39775777 |
taagtggaaaatatct |
39775762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University