View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1294_high_4 (Length: 251)
Name: NF1294_high_4
Description: NF1294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1294_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 5033531 - 5033743
Alignment:
| Q |
15 |
agaattgttttagctaatcactaggttaaggttgaaattatctgacacttagccatacgagtctctcatagactagttttctacaacagattttaactac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5033531 |
agaattgttttagctaatcactaggttaaggttgaaattatctgacacttggccatacgagtctctcatagacaagttttctacaacagattttaactac |
5033630 |
T |
 |
| Q |
115 |
ataaactaaatttcacctttt-atatgca----cctttttcatggcaatgacacattgatttttatgagttgcaattaaggtgtttgatgaaagacttga |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033631 |
ataaactaaatttcaccttttaatatgcaattctatttttcatggcaatgacacattgatttttatgagttgcaattaaggtgtttgatgaaagacttga |
5033730 |
T |
 |
| Q |
210 |
ggagagtgatttc |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5033731 |
ggagagtgatttc |
5033743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 136
Target Start/End: Complemental strand, 5026413 - 5026368
Alignment:
| Q |
91 |
ttttctacaacagattttaactacataaactaaatttcacctttta |
136 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
5026413 |
ttttctacaacagatgttaattacataaaataaatttcacctttta |
5026368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University