View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1294_low_10 (Length: 306)
Name: NF1294_low_10
Description: NF1294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1294_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 98 - 220
Target Start/End: Complemental strand, 42381120 - 42380998
Alignment:
| Q |
98 |
cgaacttcgtgttaatgctaataatcccttgtaaaatagacttgtacacatcataattacnnnnnnnngtcatgtatgtgacaacattttttcaattgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42381120 |
cgaacttcgtgttaatgctaataatcccttgtaaaatagatttgtacacatcataattacttttttttgtcatgtatgtgacaacattttttcaattgat |
42381021 |
T |
|
| Q |
198 |
atgatgccatgtttcacacctat |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42381020 |
atgatgccatgtttcacacctat |
42380998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 98 - 220
Target Start/End: Complemental strand, 42409834 - 42409712
Alignment:
| Q |
98 |
cgaacttcgtgttaatgctaataatcccttgtaaaatagacttgtacacatcataattacnnnnnnnngtcatgtatgtgacaacattttttcaattgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42409834 |
cgaacttcgtgttaatgctaataatcccttgtaaaatagatttgtacacatcataattacttttttttgtcatgtatgtgacaacattttttcaattgat |
42409735 |
T |
|
| Q |
198 |
atgatgccatgtttcacacctat |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42409734 |
atgatgccatgtttcacacctat |
42409712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University