View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1294_low_14 (Length: 242)
Name: NF1294_low_14
Description: NF1294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1294_low_14 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 112 - 242
Target Start/End: Complemental strand, 9558430 - 9558300
Alignment:
| Q |
112 |
aattttaggtcaccacgacgacggtagcacgctatgtttcaatatgggaatatatgtccctagagcctagtagcctaataattgtgaaagggagagatag |
211 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9558430 |
aattttagggcaccacgacgtcggtagcacgctatctttcaatatgggaatatatgtccctagagcctagtagcctaataattgtgaaagggagagatag |
9558331 |
T |
|
| Q |
212 |
gaacgtatatgatgagacagttcaatgaggt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9558330 |
gaacgtatatgatgagacagttcaatgaggt |
9558300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 21 - 107
Target Start/End: Complemental strand, 9558555 - 9558469
Alignment:
| Q |
21 |
actaaatctataactgacccaatatctgaagaacagttctgcaaatgaactgagtgtttgtcatgtgcttattttctttccttaaag |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9558555 |
actaaatctataactgactcaatatctgaagaacagttctgcaaatgaactgagtgtttatcatgtgcttattttctttccttaaag |
9558469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 105 - 242
Target Start/End: Complemental strand, 9561956 - 9561821
Alignment:
| Q |
105 |
aagaaacaattttaggtcaccacgacgacggtagcacgctatgtttcaatatgggaatatatgtccctagagcctagtagcctaataattgtgaaaggga |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| ||||||||| || || |||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
9561956 |
aagaaacaattttagggcaccacgacgagggtagcacgcaatgtttcaacttg--aaaatatgtccctggtgcctagtagcctaataattgggaaaggga |
9561859 |
T |
|
| Q |
205 |
gagataggaacgtatatgatgagacagttcaatgaggt |
242 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
9561858 |
gagacaggaacgtatgtgataagacagttcaatgaggt |
9561821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University