View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1294_low_4 (Length: 363)
Name: NF1294_low_4
Description: NF1294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1294_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 164 - 267
Target Start/End: Complemental strand, 8849453 - 8849347
Alignment:
| Q |
164 |
ataaatttttatggctcaaagaacagaaaatgaagaaaccgaatttaaggtagtttcagaaacccttcaaca---aacaccaataataaatctttgtatc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8849453 |
ataaatttttatggctcaaagaacagaaaatgaagaaaccgaatttaaggtggtttcagaaacccttcaacaaacaacaacaataataaatctttgtatc |
8849354 |
T |
|
| Q |
261 |
aaaaact |
267 |
Q |
| |
|
||||||| |
|
|
| T |
8849353 |
aaaaact |
8849347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University