View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295-Insertion-12 (Length: 166)
Name: NF1295-Insertion-12
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295-Insertion-12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 10506678 - 10506526
Alignment:
| Q |
7 |
accagcaagcattaaaaggattcctttggggctggggtgcagcagcaaatagggtggtgctgttagaaatattggcatactgatgtttcttttgtgggga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
10506678 |
accagcaagcattaaaaggattcctttggggctggggtgcagcagcaaatagggtggtgctgttagaaatattgtcatactga---ttcttttgtgggga |
10506582 |
T |
|
| Q |
107 |
ctccggtggggatatatccatatcttgaaccatttcttgttcctgcaaagtttcac |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10506581 |
ctccggtggggatatatccatatcttgaaccatttcttgttcaagcaaagtttcac |
10506526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University