View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295-Insertion-14 (Length: 97)

Name: NF1295-Insertion-14
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295-Insertion-14
NF1295-Insertion-14
[»] chr1 (2 HSPs)
chr1 (8-97)||(1817122-1817211)
chr1 (13-57)||(1855992-1856036)


Alignment Details
Target: chr1 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 1817211 - 1817122
Alignment:
8 gattgtgcttcatattttcaatgttttattgaatttggttcctcttaattgagtcattttaaaactcataagagtggttgattacactaa 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1817211 gattgtgcttcatattttcaatgttttattgaatttggttcctcttaattgagtcattttaaaactcataagagtggttgattgcactaa 1817122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 1855992 - 1856036
Alignment:
13 tgcttcatattttcaatgttttattgaatttggttcctcttaatt 57  Q
    |||||||||| |||||||||||||||||||||||| |||||||||    
1855992 tgcttcatatcttcaatgttttattgaatttggtttctcttaatt 1856036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University