View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295-Insertion-14 (Length: 97)
Name: NF1295-Insertion-14
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295-Insertion-14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 1817211 - 1817122
Alignment:
| Q |
8 |
gattgtgcttcatattttcaatgttttattgaatttggttcctcttaattgagtcattttaaaactcataagagtggttgattacactaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1817211 |
gattgtgcttcatattttcaatgttttattgaatttggttcctcttaattgagtcattttaaaactcataagagtggttgattgcactaa |
1817122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 1855992 - 1856036
Alignment:
| Q |
13 |
tgcttcatattttcaatgttttattgaatttggttcctcttaatt |
57 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
1855992 |
tgcttcatatcttcaatgttttattgaatttggtttctcttaatt |
1856036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University