View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12950_low_12 (Length: 249)
Name: NF12950_low_12
Description: NF12950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12950_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 4 - 236
Target Start/End: Complemental strand, 19159305 - 19159073
Alignment:
| Q |
4 |
tccagattggcagcaatattattccgataagaacaacttctttgatcagcacagtttcgatgaatttccctatgcaagggcagtctgatcgagagatacc |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19159305 |
tccagattggcagcagtattattccgataaggataacttctttgatcagcacaatttcgatgaatttccctatgcaagggcaggacgatcgagagatacc |
19159206 |
T |
 |
| Q |
104 |
atggtcctacgcgatggtggttatcaggtgcataatcatacgcgttccaattatcgttcctacgggaaagagaatgtgcaccctgtggataccattgagg |
203 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
19159205 |
atggtcttgcgcgatggtggttatcaggtgcaaaatcatacgcgttccaattatcgttcctacgggaaagagaatatgcaccatgtggataccattgagg |
19159106 |
T |
 |
| Q |
204 |
ctgatcacatgaaataaaggaaggtacacaggt |
236 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
19159105 |
ttgatcacgtgaaataaaggaaggtacacaggt |
19159073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University