View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12950_low_3 (Length: 483)
Name: NF12950_low_3
Description: NF12950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12950_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 4 - 322
Target Start/End: Original strand, 3935032 - 3935350
Alignment:
| Q |
4 |
gcattggccacgacgccgtttcgccacctttcttcgtcttatcatttaatgacgttgaagttacaacaccatgtcagcattggagatagacggagcattc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3935032 |
gcattggccacgacgccgtttcgccacctttcttcgtcttatcatttaatgacgttgaagttacaacaccatgtcagcattggagagagacggagcattc |
3935131 |
T |
|
| Q |
104 |
gagtggttagaattacggcatcattgtggccaaataccgactcaactgtttctcagccatcgccgggggaatcaaatggtgctttggagattgatagtcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3935132 |
gagtggttagaattacggcatcattgtggccaaataccgactcaactgtttctcagccatcgccggcggaatcaaatggtgctttggagattgatagtcc |
3935231 |
T |
|
| Q |
204 |
ttactcgtttttgaaatgtgatggatcaaaaaccgttcacgctggtactataatttgtctctcttttatttttctatccnnnnnnntatttgtgatcacg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3935232 |
ttactcgtttttgaaatgtgatggatcaaaaaccgttcacgctggtactataatttgtctctcttttatttttctatccaaaaaaatatttgtgatcacg |
3935331 |
T |
|
| Q |
304 |
ttgaattcatgtagaaggt |
322 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
3935332 |
ttgaattcatgtggaaggt |
3935350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University