View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12950_low_9 (Length: 277)
Name: NF12950_low_9
Description: NF12950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12950_low_9 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 107 - 272
Target Start/End: Original strand, 41138017 - 41138186
Alignment:
| Q |
107 |
tgttcctctccaatttgggaggtatggaataactattcttctctta----taattataatattactcttttgccttttttgattgctttgaaatgttttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41138017 |
tgttcctctccaatttgggaggtatggaataactattcttctcttacttatacttataatattactcttttgccttttttgattgctttgaaatgttttt |
41138116 |
T |
 |
| Q |
203 |
gtattggactgggttttcttctctagtactcaacttacgacttcctcttcacctcattccctttgcttct |
272 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41138117 |
gtattggactgggttttcttctctagtgctcaacttacgacttcctcttcacctcattcccttttcttct |
41138186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Complemental strand, 90662 - 90616
Alignment:
| Q |
53 |
ctttcctatggtagaaaatgattaatctttcccatgtgaaataccac |
99 |
Q |
| |
|
|||||||||||| |||||||||| | |||||||||||||||| |||| |
|
|
| T |
90662 |
ctttcctatggtggaaaatgattcacctttcccatgtgaaatgccac |
90616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 53 - 94
Target Start/End: Original strand, 4895121 - 4895162
Alignment:
| Q |
53 |
ctttcctatggtagaaaatgattaatctttcccatgtgaaat |
94 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
4895121 |
ctttcccatggtggaaaatgattaacctttcccatgtgaaat |
4895162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University