View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12950_low_9 (Length: 277)

Name: NF12950_low_9
Description: NF12950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12950_low_9
NF12950_low_9
[»] chr5 (1 HSPs)
chr5 (107-272)||(41138017-41138186)
[»] scaffold0039 (1 HSPs)
scaffold0039 (53-99)||(90616-90662)
[»] chr7 (1 HSPs)
chr7 (53-94)||(4895121-4895162)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 107 - 272
Target Start/End: Original strand, 41138017 - 41138186
Alignment:
107 tgttcctctccaatttgggaggtatggaataactattcttctctta----taattataatattactcttttgccttttttgattgctttgaaatgttttt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    || |||||||||||||||||||||||||||||||||||||||||||||||    
41138017 tgttcctctccaatttgggaggtatggaataactattcttctcttacttatacttataatattactcttttgccttttttgattgctttgaaatgttttt 41138116  T
203 gtattggactgggttttcttctctagtactcaacttacgacttcctcttcacctcattccctttgcttct 272  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||    
41138117 gtattggactgggttttcttctctagtgctcaacttacgacttcctcttcacctcattcccttttcttct 41138186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 99
Target Start/End: Complemental strand, 90662 - 90616
Alignment:
53 ctttcctatggtagaaaatgattaatctttcccatgtgaaataccac 99  Q
    |||||||||||| |||||||||| | |||||||||||||||| ||||    
90662 ctttcctatggtggaaaatgattcacctttcccatgtgaaatgccac 90616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 53 - 94
Target Start/End: Original strand, 4895121 - 4895162
Alignment:
53 ctttcctatggtagaaaatgattaatctttcccatgtgaaat 94  Q
    |||||| ||||| |||||||||||| ||||||||||||||||    
4895121 ctttcccatggtggaaaatgattaacctttcccatgtgaaat 4895162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University