View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12951_low_3 (Length: 318)
Name: NF12951_low_3
Description: NF12951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12951_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 2466819 - 2466519
Alignment:
| Q |
1 |
atttatcaaatgtttttctctctggtgatagtgctggtggtaacatttctcattatgttgctgttaaagctattcaaaatgatgggttttgtcctgtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466819 |
atttatcaaatgtttttctctctggtgatagtgctggtggtaacatttctcattatgttgctgttaaagctattcaaaatgatgggttttgtcctgtgaa |
2466720 |
T |
 |
| Q |
101 |
gattaaaggggttatacttatacatccttattttgggagtgagaaaaggactgagaaagagatggagaaagaaggaggtgttgaggatgtgaaaatgaat |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2466719 |
gattaaaggggttatgcttatacatccttattttgggagtgagaaaaggactgagaaagagatggaggaagaaggaggtgttgaggatgtgaaaatgaat |
2466620 |
T |
 |
| Q |
201 |
gatatgttttggagattgagtttgcctgaagattcggaccgcaannnnnnnggttgtaattttgagaaagatgatgtgagtgagagtgtttggttgaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466619 |
gatatgttttggagattgagtttgcctgaagattcggaccgcgatttttttggttgtaattttgagaaagatgatgtgagtgagagtgtttggttgaagt |
2466520 |
T |
 |
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
2466519 |
t |
2466519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University