View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12952_high_37 (Length: 252)
Name: NF12952_high_37
Description: NF12952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12952_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 43 - 240
Target Start/End: Complemental strand, 46778241 - 46778044
Alignment:
| Q |
43 |
gacatgttacatactttgttatctatctcaaatcattcctctaacaaataatgcatagatcttcatcttattcatctactattgtaagagcatctgatga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46778241 |
gacatgttacatactttgttatctatctcaaatcattcctctaacaaataatgcatagatcttcatcttattcatctactattgtaagagcaactgatga |
46778142 |
T |
 |
| Q |
143 |
gttttcagttgacatttcatcaacacttttagcagcttcctcttctcttcaaatggcaacttctaatggaatattgccaatacttcgctctatctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46778141 |
gttttcagttgacatttcatcaacacttttagcagcttcctcttctcttcaaatggcaacttctaatggaatattgccaatacttcgctctatttctg |
46778044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University