View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12952_low_37 (Length: 253)
Name: NF12952_low_37
Description: NF12952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12952_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 41830144 - 41830388
Alignment:
| Q |
1 |
cgtaggaacacaaatattattggatcagaatgaaaaatcaagaaaataaaaaggaggaaacatctttcatcaactcctcaaaatcccattctcccaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830144 |
cgtaggaacacaaatattattggatcagaatgaaaaatcaagaaaataaaaaggaggaaacatctttcatcaactcctcaaaatcccattctcccaagtt |
41830243 |
T |
 |
| Q |
101 |
gaattgttcttgaaataaattctccacta---cacccctactttcaatttcattattattgctttcaataatattgcagttactaagcatattgtttatc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830244 |
gaattgttcttgaaataaattctccactacttcacccctactttcaattttattattattgctttcaataatattgcagttactaagcatattgtttatc |
41830343 |
T |
 |
| Q |
198 |
tttatgtcatcaaaataataatcagaatggttagggttagtttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830344 |
tttatgtcatcaaaataataatcagaatggttagggttagtttct |
41830388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University