View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12952_low_39 (Length: 250)
Name: NF12952_low_39
Description: NF12952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12952_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 32167471 - 32167250
Alignment:
| Q |
18 |
actttgtatagataacatgaatgatatcttagttattgttatttcaagaaaacaacatatccttgagagtatgctgaagaccatatgttattgttattta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32167471 |
actttgtatagataacatgaatgatatcttagttattgttatttcaagaaaacaacatatccttgagagtatgctgaagaccatatgttattgttattta |
32167372 |
T |
 |
| Q |
118 |
atatctgtgaacctgcttgattattggggaaaggagtagtaaatatctatatctcatgctaatttactctagcatgccaaatatcaactttttgtttact |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
32167371 |
atatctgtgaacctgcttgattattgaggaaaggagtagtaaatatctatatctcatgctactttactctaacatgccaaatatcaactgtttgtttact |
32167272 |
T |
 |
| Q |
218 |
acttctcctaggttcttctcac |
239 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
32167271 |
acttctcctaggttcttgtcac |
32167250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University