View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12952_low_40 (Length: 239)
Name: NF12952_low_40
Description: NF12952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12952_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 46778396 - 46778618
Alignment:
| Q |
1 |
cataatttaaatttgtttaataattcaaaatactaaacttaaatagacaaataaattttgatcaaacacgatgtctcaactgtgtaaaatttcgatccca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
46778396 |
cataatttaaatttgtttaataattcaaaatactaaacttaaatagacaaataaattttgatcgagcacgacgtctcaactgcgcaaaatttcgatccca |
46778495 |
T |
 |
| Q |
101 |
tatcctagttgagttattttagaggatgtggtctacttgcttgcttagctgtggttacaatttgatgaagtataaagtaaagataaaatttagaagtcaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46778496 |
tatcttagttgagttattttagaggatgtagtctacttgcttgcttagctgtggttacaatttgatgaagtataaagtaaagataaaatttagaagtcaa |
46778595 |
T |
 |
| Q |
201 |
catattaagtataggtcgaagct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46778596 |
catattaagtataggtcgaagct |
46778618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University