View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12953_high_26 (Length: 230)
Name: NF12953_high_26
Description: NF12953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12953_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 44360599 - 44360754
Alignment:
| Q |
15 |
gcagagaaagtatgagcaattttgtttcaaaactggattttactctacaattgctatataaacattcacatctatattttctgtatagattattgataca |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44360599 |
gcagagaaagtatgagc--ttttgtttcaaaactggattttactctacaattgctat--------------ctatattttctgtatagattattgataca |
44360682 |
T |
 |
| Q |
115 |
ttgataaatatcataagaaattaaacgacccttgaggaaatgtatagatgaaaacatgtgtacttatgtata |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44360683 |
ttgataaatatcataagaaattaaacgacccttgaggaaatgtatagatgaaaacatgtgtacttatgtata |
44360754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 214
Target Start/End: Original strand, 44360771 - 44360801
Alignment:
| Q |
184 |
atatgaaccagagactattgagagatgcaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44360771 |
atatgaaccagagactattgagagatgcaat |
44360801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University