View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12953_low_11 (Length: 444)
Name: NF12953_low_11
Description: NF12953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12953_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 9 - 301
Target Start/End: Original strand, 48092056 - 48092358
Alignment:
| Q |
9 |
agcagagagtgagtggtcttattggacctgaacaaactcagagcttagtgaatggagcattagtactcatcactcttggaggaaatgattttgtgaataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48092056 |
agcagagagtgagtggtcttattggacctgaacaaactcagagcttagtgaatggagcattagtactcatcactcttggaggaaatgattttgtgaataa |
48092155 |
T |
 |
| Q |
109 |
ctattacttagtgccattctctgcaagatcacgccaatacaatttaccggattatgtcagatatataatatctgaatataagaagattttgagggtaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48092156 |
ctattacttagtgccattctctgcaagatcacgccaatacaatttaccggattatgtcagatatataatatctgaatataagaagattttgagggtaaat |
48092255 |
T |
 |
| Q |
209 |
tactctctttttcattgcatgtgatccatt----------atttgatttgatttatttcacggtcaaattatataaataattggttagtagtatcaatca |
298 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48092256 |
tactctctttttcatagcatgtgatccattatttgatttgatttgatttgatttatttcacggtcaaattatataaataattggttagtagtatcaatca |
48092355 |
T |
 |
| Q |
299 |
tgg |
301 |
Q |
| |
|
||| |
|
|
| T |
48092356 |
tgg |
48092358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 336 - 423
Target Start/End: Original strand, 48092352 - 48092439
Alignment:
| Q |
336 |
atcatggatatatggcgtagaagtcagataaattttgtatcaaacataagattggataaaaagtgacatgatgtaatgtggagtgtgc |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48092352 |
atcatggatatatggcgtagaagtcagataaattttgtatcaaacataagattggataaaaagtgacatgatgtaatgtggagtgtgc |
48092439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University