View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12953_low_15 (Length: 417)
Name: NF12953_low_15
Description: NF12953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12953_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 49758458 - 49758726
Alignment:
| Q |
1 |
caaactgaattgagtagacaaccattttctgctggccaaaatagagtatatgtttcaggagcctcaaagagagcgggatgatggatcaattagaattcta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49758458 |
caaactgaattgagtagacaacctttttctgctggcgaaaatagagtatatgtttcaggagcctcaaagagagcggtatgatggatcaattagaattcta |
49758557 |
T |
 |
| Q |
101 |
tccctttttcttaggccttcatcaattagtaagtcaaccaatttaacctggataccgcgagtttnnnnnnnnntaatcaaccatttcatcttcatctagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
49758558 |
tccctttttcttaggccttcatcaattagtaagtcaaccaatttaacctggataccgcgagttttaaaaaaaataatcaaccaattcatcttcatctagg |
49758657 |
T |
 |
| Q |
201 |
acaatgggacgactccatattgaaggcataacttgtgccggcattcaaatgtcttctcatattttgaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
49758658 |
acaatgggacgactccatattgaaggcataacttgtgccggcattcaaatgtcttttgatattttgaat |
49758726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University