View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12953_low_22 (Length: 286)
Name: NF12953_low_22
Description: NF12953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12953_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 24 - 268
Target Start/End: Complemental strand, 50356351 - 50356113
Alignment:
| Q |
24 |
ttcaaattcaaattcctcccaagagccataaccaacctttaactctcgattttactaaaccttacacctttagatctaaccctaaatccttagatctaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50356351 |
ttcaaattcaaattcctcccaagagccataaccaacctttaactctcgattttactaaaccttacacctttatatctaaccctaaatccttagatctaga |
50356252 |
T |
 |
| Q |
124 |
aatccccaaggaaacatttagttttccatcactcctgtcctccgccatcacctgcgacggcagtgtttccaatggcaggctaggtccatgtccatgtcca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
50356251 |
aatccccaaggaaacatttagttttccatcactcctgtcctccgccatcaccggcgacggcagtgtttccgatggcaggctaggtccatgt------cca |
50356158 |
T |
 |
| Q |
224 |
tctatcatccccacccccgctgtctcccaaggtaaacagcctctt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50356157 |
tctatcatccccacccccgctgtctcccgaggtaaacagcctctt |
50356113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University