View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12953_low_27 (Length: 249)
Name: NF12953_low_27
Description: NF12953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12953_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 48364678 - 48364877
Alignment:
| Q |
1 |
aatatattttccctcgtaattgccgcaaatcacaaggggtattaccgacatagattatc-acaaacaaataatgagacaaacaacctcaaattcaatggc |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
48364678 |
aatatattttcccttgtaattgccgcaaatcacaaggggtattaccgacatagattatccacaaacaaagaatgagacaaccaacctcaaattcaatggc |
48364777 |
T |
 |
| Q |
100 |
ataacaagtaaatccaaccactccacatgttttgtttttggagttcatcaccaatttattccatctcccaacaaagaatcttcaacttcaacccaatcca |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48364778 |
ataaaaagtaaatccaaccactccacatgttttgtttttggagttcatcaccaatttattccatctcccaacaaagaatcttcaacttcaacccaatcca |
48364877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University