View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12954_high_10 (Length: 410)
Name: NF12954_high_10
Description: NF12954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12954_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 148 - 267
Target Start/End: Original strand, 39765395 - 39765514
Alignment:
| Q |
148 |
tcactctaaaattaaaagatatagacagcnnnnnnngaatatacaaataaatcacgtttcacatttataaacaagggaaatcatgtttctcattgtttca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39765395 |
tcactctaaaattaaaagatatagacagcaaaaaaagaatatacaaataaatcacgtttcacatttataaacaagggaaatcatgttcctcattgtttca |
39765494 |
T |
 |
| Q |
248 |
tgaatcatgataaatatact |
267 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39765495 |
tgaatcatgataaatatact |
39765514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 39765297 - 39765390
Alignment:
| Q |
19 |
gtatagcaatgctgttttcaatattatgacatgatgaactcatgtgaaaagtgttaacggtacatgtcagcacaaaaattcaattttcaaaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39765297 |
gtatagcaatgctgttttcaatattatgacatgatgaactcatgtgaaaagtgttaacggtacatgtcagcacaaaaattcaattttcaaaatt |
39765390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 311 - 400
Target Start/End: Original strand, 39765558 - 39765647
Alignment:
| Q |
311 |
caatgatacgaggaaacactatacctcaggtgccgtgtttctgggtgatctacggtcagtgactttggagcttttgtcgtttgatgatgt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39765558 |
caatgatacgaggaaacactatacctcaggtgccgtgtttctgggtgatctacggtcagtgactttggagcttttgtcgtttgatgatgt |
39765647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 325 - 377
Target Start/End: Original strand, 39759397 - 39759449
Alignment:
| Q |
325 |
aacactatacctcaggtgccgtgtttctgggtgatctacggtcagtgactttg |
377 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||| ||| ||||||||| |
|
|
| T |
39759397 |
aacaatatacctcaggtaccgtgcttctgggtgatctaatgtcggtgactttg |
39759449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University