View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12954_low_15 (Length: 307)
Name: NF12954_low_15
Description: NF12954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12954_low_15 |
 |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 11737 - 11880
Alignment:
| Q |
1 |
tgaatagaaattcatgatacctaatagaaatccaacaaaaccaggaagcataaaaacaaannnnnnnngaataagtttttctatgaggtactagaaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
11737 |
tgaatagaaattcatgatacctaatagaaatccaacaaaaccaggaagcataaaaacaaattttttttgaataagtttttctatgaggtactagtaagca |
11836 |
T |
 |
| Q |
101 |
accaaacttcacggcacttaaaaattctcttttttataatgttc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11837 |
accaaacttcacggcacttaaaaattctcttttttataatgttc |
11880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 209 - 291
Target Start/End: Original strand, 11946 - 12028
Alignment:
| Q |
209 |
gaccgaaatgtttaaagtattattgtttgaagnnnnnnnttagaggaactaaaaacaaaatacgatatatttatagaatttaa |
291 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11946 |
gaccgaaatatttaaagtattattgtttgaagaaaacaattagaggaactaaaaacaaaatacgatatatttatagaatttaa |
12028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University