View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12954_low_18 (Length: 276)
Name: NF12954_low_18
Description: NF12954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12954_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 40 - 232
Target Start/End: Complemental strand, 36465119 - 36464927
Alignment:
| Q |
40 |
tttatagtatattactagctacatgattgccttgtacaagactataatactaatacatattgattttaaagcagatttttatgatgcaaatccgacgtaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465119 |
tttatagtatattactagctacatgattgccttgtacaagactataatactaatacatattgattttaaagcagatttttatgatgcaaatccgacgtaa |
36465020 |
T |
 |
| Q |
140 |
atcattacttacaatgtctacatagataagggttatagcgatttcaacatagataaggaagttcactaacacaagagaattagaagttacctt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465019 |
atcattacttacaatgtctacatagataagggttatagcgatttcaacatagataaggaagttcactaacacaagagaattagaagttacctt |
36464927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University