View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12955_low_5 (Length: 378)
Name: NF12955_low_5
Description: NF12955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12955_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 36740897 - 36741264
Alignment:
| Q |
1 |
ttcctcccttcaatttgacttcatatctgatggctatgatgaaggtggctttactcaagttggcaacatatcaacctatctatctcacatgcaagccata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36740897 |
ttcctcccttcaatttgacttcatatctgatggctatgatgaaggtggctttactcaagttggcaacatatcaacctatctatctcacatgcaagccata |
36740996 |
T |
 |
| Q |
101 |
ggctccaagaatttgaaggaactcattcaaaaacataatgtttctgatcaccctatagattgtgtagtatatgacccttttcttcaatgggttttggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36740997 |
ggctccaagaatttgaaggaactcattcaaaaacataatgtttctgatcaccctatagattgtgtagtatatgacccttttcttcaatgggttttggatg |
36741096 |
T |
 |
| Q |
201 |
tagccaaagaattcaacataattggagctgcttttttcactcaaatgtgtgctgtcaattacatgtattattatgtttaccatggacttttaaagcttcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36741097 |
tagccaaagaattcaacataattggagctgcttttttcactcaaatgtgtgctgtcaattacatgtattattatgtttaccatggacttttaaagcttcc |
36741196 |
T |
 |
| Q |
301 |
tatatcttcaatgccaatttctataccaggacttcctttgcttgagctcaaagatacaccttcctttg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36741197 |
tatatcttcaatgccaatttctataccaggacttcctttgcttgagctcaaagatacaccttcctttg |
36741264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University