View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12956_low_6 (Length: 321)
Name: NF12956_low_6
Description: NF12956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12956_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 13 - 302
Target Start/End: Original strand, 55940696 - 55940986
Alignment:
| Q |
13 |
aatatttatccccaggggcttactgaaaatataaatgcagagtctggtccagaagaaagcaaaataatagactgataaaaacaggtaagcatgaagttac |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55940696 |
aatatttatccccgggggcttactgaaaatataaatgcagagtctggtccagaagaaagcaaaataatagactgataaaaacaggtaagcatgaagttac |
55940795 |
T |
 |
| Q |
113 |
tatcctacgttgaagtatatatgggattgcactgaaaacaataattctttgaacattgaaataggttttataacctatgaagcacaaacacagattcgga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55940796 |
tatcctacgttgaagtatatatgggattgcactgaaaacaataatggtttgaacattgaaataggttttataacctatgaagcacaaacacagattcgga |
55940895 |
T |
 |
| Q |
213 |
caccgaacgttctcagaaaggaatttaattccaataatttcataaacaatgaagcaca-acgctttgcggattaaacgtgttctagtgtcg |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55940896 |
caccgaacattctcagaaaggaatttaattccaataatttcataaacaatgaagcacagacgctttgcggattaaacgtgttctagtgtcg |
55940986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University