View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12956_low_7 (Length: 278)
Name: NF12956_low_7
Description: NF12956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12956_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 271
Target Start/End: Original strand, 6057458 - 6057708
Alignment:
| Q |
21 |
ttagagacttaagggaagcatgtaacaaaccttcctttgggaaagacttgatcccatcacatggaccttgaattgttacatcagtaagcatgtccatgga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6057458 |
ttagagacttaagggaagcatgtaacaaaccttcctttgggaaagatttgatcccatcacatggaccttgaattgttacatcagtaagcatgtccatgga |
6057557 |
T |
 |
| Q |
121 |
aggccaggacaggccagtaagtagtttctcgcaattcatgatgcgaatcgatctcaacttaggtggcataccactttcgggaaatgattcaatttctgga |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6057558 |
aggccaggacagaccagtaagtagtttctcgcaattcatgatgcgaatcgatctcaacttaggtggcataccactttcggggaatgattcaatttctgga |
6057657 |
T |
 |
| Q |
221 |
cagttttctagtcggaaatattctaactttggaagaagaatgttcatctca |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6057658 |
cagttttctagtcggaaatattctaactttggaagaagaatgttcatctca |
6057708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University