View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12957_high_16 (Length: 228)
Name: NF12957_high_16
Description: NF12957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12957_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 42527315 - 42527121
Alignment:
| Q |
15 |
aatatataaacaacatattgtagctactatcatataggaacgctaatggaagtaggtttaaggagttgactcacccgtaaagttacgagttcaacttccg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42527315 |
aatatataaacaacatattgtagctactatcatataggaacgctaatgaaagtaggtttaaggagttgactcacccataaagttacgagttcaacttccg |
42527216 |
T |
 |
| Q |
115 |
tcgataatacaagaacatctttaatagattatttgttagtaccacgataaccatttattgtgtgccttaacacatgtcttaaccttgttgaaccc |
209 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
42527215 |
tcgataatacaaggacatttttaatagattatttgttagtaccacgataaccattcgttgtgtgccttaacacatgtcttgacctttgtgaaccc |
42527121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University