View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12957_low_12 (Length: 369)
Name: NF12957_low_12
Description: NF12957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12957_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 19 - 358
Target Start/End: Complemental strand, 33126850 - 33126511
Alignment:
| Q |
19 |
gttttgttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126850 |
gttttgttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggagg |
33126751 |
T |
|
| Q |
119 |
tggaggaatttttatccctatgctcactttgattattggttttgatccaaagtcttctacagccctctctaagtgttagtatatttctatcttatgttta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126750 |
tggaggaatttttatccctatgctcactttgatcattggttttgatccaaagtcttctacagccctctctaagtgttagtatatttctatcttatgttta |
33126651 |
T |
|
| Q |
219 |
ttcattcttgttagatatatagtcgatgtttggatttacgtttcaattatctttctcacgtctcaaatacagttttggacctgaaattggtgaagctaca |
318 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33126650 |
ttcattcttgttagatgtatagtcgatgtttggatttacgtttcaattatctttctcacgtctcaaatacagttttggacctgaaattggtgcagctaca |
33126551 |
T |
|
| Q |
319 |
aatagtagcatgtggctggtcgcgattcagaagctatatg |
358 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
33126550 |
aatagtagcatgtggttggctgcgattcagaagctatatg |
33126511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 24 - 182
Target Start/End: Original strand, 7568570 - 7568728
Alignment:
| Q |
24 |
gttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggaggtggag |
123 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||| | || || || ||| | |||||||| |||||||| ||||||||||| ||||| ||||||||||| | |
|
|
| T |
7568570 |
gttgagcaggaaatgaaatttgattggaaaattatagttggatcaattattggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtg |
7568669 |
T |
|
| Q |
124 |
gaatttttatccctatgctcactttgattattggttttgatccaaagtcttctacagcc |
182 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
7568670 |
gaatttttgtccctatgcttgctttgatcattggctttgatcccaagtcttctacagcc |
7568728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 283
Target Start/End: Original strand, 32663699 - 32663744
Alignment:
| Q |
238 |
tagtcgatgtttggatttacgtttcaattatctttctcacgtctca |
283 |
Q |
| |
|
||||| |||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
32663699 |
tagtcaatgtttggatttacatttgaattgtctttctcacgtctca |
32663744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University