View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12957_low_13 (Length: 367)
Name: NF12957_low_13
Description: NF12957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12957_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 55 - 358
Target Start/End: Original strand, 41342514 - 41342821
Alignment:
| Q |
55 |
gcattgcatttggctcactcaacgttgagttgccacttgaactctcacttccacttcgattggaagccaatgaaggtaa----gagaaacaataagttgg |
150 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41342514 |
gcattgtatttggcttactcaacgttgagttgccacttgaactctcacttccacttcgattggaagccaatgaaggtaagtaagagaaacaataagttgg |
41342613 |
T |
 |
| Q |
151 |
ctcttaagtttttacagattcaatcttaaatatataatgttgactctagccggtcaaagaattttcattagtcggtgaagcctaaaacaaattttaaaac |
250 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342614 |
ctcttaagtttttaaatattctatcttaaatatataatgttgactctagccggtcaaagaattttcattagtcggtgaagcctaaaacaaattttaaaac |
41342713 |
T |
 |
| Q |
251 |
attagannnnnnngttggtgggctttcaagttagagttttagtaatctta-ccttgtgatggtcatgtgttgatcacaacttagcaattggacaataatt |
349 |
Q |
| |
|
|| ||| |||||||||| |||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41342714 |
atgagatttttttgttggtgggc-ttcaagttagagttttagtagtcttatctttgtgatggtcatgtgttgatcacaacttagcaattggacaatgatt |
41342812 |
T |
 |
| Q |
350 |
gtgatgatg |
358 |
Q |
| |
|
||||||||| |
|
|
| T |
41342813 |
gtgatgatg |
41342821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University