View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12959_low_3 (Length: 461)
Name: NF12959_low_3
Description: NF12959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12959_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 174 - 447
Target Start/End: Complemental strand, 38039207 - 38038934
Alignment:
| Q |
174 |
caggtcgatgcagcttcacttcattgatttttgttcgtttgttttttatttgatccaccgtaatttccttgattacgagtgtttgttgatgggagcatat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38039207 |
caggtcgatgcagcttcacttcattgatttttgttcgtttgttttttatttgatccaccgtaatttccttgattatgagtgtttgttgatgggagcatat |
38039108 |
T |
|
| Q |
274 |
tcaccaacaaaccatgcaagccaccgtctcaaagtaacatcatgtgtaatttcggtaagaaagtttccactgatatcattctgtatcttgagcttatctt |
373 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
38039107 |
tcaccatcaaaccatgcaagccaccgtctcaaagtaacatcatgtgtaatttcggtaagaaagtttccactgatatgattctgtatcttgagcttctctt |
38039008 |
T |
|
| Q |
374 |
tcttcctccataacaatctcaccacataatatctgatgttaatctttttgattatgtgcttgtgcagcccaaag |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
38039007 |
tcttcctccataacaatctcaccacataatatctgatgttaatctttttgattatctgcttgagcagcccaaag |
38038934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 38039381 - 38039305
Alignment:
| Q |
1 |
acaggacaacaccaccgtcaccggagcttcacaccggaacattacttccgtcatggtgtcctttccttcaaaggtta |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38039381 |
acaggacaacaccaccgtcaccggagcttcacaccggaacattactgccgtcatggtgtcctttccttcaaaggtta |
38039305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University