View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295R-Insertion-10 (Length: 119)
Name: NF1295R-Insertion-10
Description: NF1295R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295R-Insertion-10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 9 - 119
Target Start/End: Complemental strand, 22045034 - 22044924
Alignment:
| Q |
9 |
aatcttatgcttgctaatttctttctcaattaatttactatgtatgtaaacttatctaacttataatcattattctacatggtacttttccctattttcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22045034 |
aatcttatgcttgctaatttctttctcaattaatttactatgtatgtaaacttagctaacttataatcattattctacatagtacttttccctattttcc |
22044935 |
T |
 |
| Q |
109 |
atttggttcgg |
119 |
Q |
| |
|
||||||||||| |
|
|
| T |
22044934 |
atttggttcgg |
22044924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University