View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295R-Insertion-12 (Length: 99)
Name: NF1295R-Insertion-12
Description: NF1295R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295R-Insertion-12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 55954380 - 55954290
Alignment:
| Q |
9 |
attttgcaaacatagatcctctgcaactacaatacaatcatattttgttgtcatattctagactttttgtataaattaaaatgtaacacta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55954380 |
attttgcaaacatagatcctctgcaactacaatacaatcatattttgttgtcatattctagactttttgtataaattaaaatgtaacacta |
55954290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University