View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295R-Insertion-7 (Length: 247)
Name: NF1295R-Insertion-7
Description: NF1295R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295R-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 36322645 - 36322405
Alignment:
| Q |
9 |
gtatgtgactataagttaagtgtataagactgtttatgtacctttggacagatttcttatgactatctagtactatcataagacactttgtattaataat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
36322645 |
gtatgtgactataagttaagtgtataagactgtttatgtacctttggacagatttcttatgactatctagtactattataagacactttgtattaattat |
36322546 |
T |
|
| Q |
109 |
gttctagacta--atatagggtgttccacaaaatctcaccacaaagccctcaaccgaaaagccccttttaagttcccctgttgattttgtctcgcaccca |
206 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36322545 |
gttctagactataatatagggtgttccacaaaatctcaccacaaagccctcaaccgaaaagccccttttaagttcccctgttgattttgtctcgcaccca |
36322446 |
T |
|
| Q |
207 |
aagaacctcacaagaaacattcaacacaagagccctgatgt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36322445 |
aagaacctcacaagaaacattcaacacaagagccctgatgt |
36322405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University