View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295R-Insertion-8 (Length: 209)
Name: NF1295R-Insertion-8
Description: NF1295R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295R-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 40 - 209
Target Start/End: Original strand, 19344187 - 19344357
Alignment:
| Q |
40 |
tcattattttatagaagaaatacaggtcccttcccttgtgactgtttgataaaatttggtgattgttaacagctcaagctttatgggaagagaggggtct |
139 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344187 |
tcattattttatagaagaaatataggtcccttcccttttgactgtttgataaaatttggtgattgttaacagctcaagctttatgggaagagaggggtct |
19344286 |
T |
|
| Q |
140 |
acaaagataccaaattgcatgagcaagatggaaagatatttgaaaaagatgggata-tatacaactgtgcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19344287 |
acaaagataccaaattgcatgagcaagatggaaagatatttgaaaaagatgggatattatacaactgtgcc |
19344357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University