View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295R-Insertion-9 (Length: 169)
Name: NF1295R-Insertion-9
Description: NF1295R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295R-Insertion-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 50246624 - 50246552
Alignment:
| Q |
9 |
tatatttgttcttgggatcccaattggagtcaaattcatacttgtcatcaagatgatcctataccatatagaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50246624 |
tatatttgttcttgggatcccaattggagtcaaattcatacttgtcatcaagatgatcctataccatatagaa |
50246552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 50246509 - 50246464
Alignment:
| Q |
124 |
ctcgtggataatgttggtgatatcttataaatttatatttggtttg |
169 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
50246509 |
ctcgtggataatgtcggtgatatcttataaatctatatttggtttg |
50246464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University