View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_24 (Length: 305)
Name: NF1295_high_24
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 59 - 292
Target Start/End: Original strand, 26047126 - 26047359
Alignment:
| Q |
59 |
gccctaacctctcggctggaaaaccctaaacccctcaactcatgaatcaacggcttcaacctatcctcaatacaaaatcccaaaaccttaggaaacaatc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26047126 |
gccctaacctctcggctggaaaaccctaaacccctcaactcatgaatcaacggcttcaacctatcctcaatagaaaatcccaaaaccttaggaaacaatc |
26047225 |
T |
|
| Q |
159 |
taacaaccctatcaatttcatccttaggaaccccaaattccataagaaaattaatgacaccaacaatttgagtttcccccattacaactgcactgggaaa |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26047226 |
taacaaccctatcaatttcatccttaggaaccctaaattccataagaaaattaatgacaccaacaatttgagtttcccccattacaactgcactgggaaa |
26047325 |
T |
|
| Q |
259 |
ttcctccaaaacccttatcaaaacatcatcagaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26047326 |
ttcctccaaaacccttatcaaaacatcatcagaa |
26047359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University