View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_25 (Length: 301)
Name: NF1295_high_25
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 7 - 291
Target Start/End: Complemental strand, 30543118 - 30542835
Alignment:
| Q |
7 |
ttaacaatggcggtggttgaagcactcatatcattattcaccttgttttcttctgtgtggacacgttattaattaatcttttcttataaagtatggttta |
106 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30543118 |
ttaacaatggcggtggttgaaacactcatatcattattcaccttgttttcttctgtgggtacacgttattaattaatcttttcttataaagtatggttta |
30543019 |
T |
|
| Q |
107 |
ttattatttaaattttgcatgcatcactcatatcagtgatttctttttatgattccatttattttgtccattacaacccatatatatgacgagggggaat |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30543018 |
ttattatttatattttgcatgcatcactcatatcagtgatttctttttatgattccatttattttgtccattacaacccatatatatgacga-ggggaat |
30542920 |
T |
|
| Q |
207 |
agcggtgcatgtgatgtgatccaatactatggatactgttcataatggctcatccataggaacctctctacactctatccctatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
30542919 |
agcggtgcatgtgatgtgatccaatattatggatactgttcataatggctcagccataggaacctctctacactctatccatatg |
30542835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University