View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_31 (Length: 260)
Name: NF1295_high_31
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 5 - 231
Target Start/End: Complemental strand, 30757250 - 30757024
Alignment:
| Q |
5 |
ttttcattttgctttgtccgatgtcacatatacaattgaggaacattggttagccataatgagcgccacacatatgttttagagctggtttctcattaaa |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757250 |
ttttcattttgctttgtccggtgtcacatatacaattgaggaacattggttagccataatgagcgccacacatatgttttagagctggtttctcattaaa |
30757151 |
T |
|
| Q |
105 |
ctgaagcagaaggtgatgaaacttcttttatttttgttgtttctaaaagtcgaaagaagaaaaataatcgcgaagcatatccaaccccgctcaaagggtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757150 |
ctgaagcagaaggtgatgaaacttcttttatttttgttgtttctaaaagtcgaaagaagaaaaataatcgcgaagcatatccaaccccgctcaaagggtt |
30757051 |
T |
|
| Q |
205 |
cacgttcaccatcatctattcgccaat |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30757050 |
cacgttcaccatcatctattcgccaat |
30757024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University